Next Generation Sequencing nelle malattie non emopatiche

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Next Generation Sequencing nelle malattie non emopatiche"

Transcript

1 Next Generation Sequencing nelle malattie non emopatiche Vilma Mantovani 1,2 & Tommaso Pipucci 2 1 Centro Ricerca Biomedica Applicata - CRBA 2 U.O. Genetica Medica Bologna, 11 maggio 2012

2 Gene discovery nelle malattie Mendeliane >7.000 malattie Mendeliane stimate circa con causa genetica identificata Analisi di linkage + positional cloning Homozigosity mapping Next Generation Sequencing Whole genome sequencing Exome sequencing

3 Exome sequencing

4 Causal genes identified by exome sequencing Bamshad, Nat Rev Genet 2011

5

6

7 10 trios, mutazioni de-novo in 9 geni, 6 delle quali probabili causative 20 trios, 21 de novo point mutations, nuovi geni candidato 14 trios, 15 de novo point mutations in 8 probandi, nuovi geni candidato

8 Exome sequencing e tratti complessi GWAS Assunto: Varianti rare che influenzano un tratto co-localizzano con varianti comuni che influenzano il rischio Exome sequencing cattura varianti con MAF<0,1 2 approcci Family-based phenotype (more distally related individuals) Extreme phenotypes

9 Exome sequencing: pitfalls Incompleta cattura di tutti gli esoni Difficoltà con CNV, riarrangiamenti, famiglie geniche Capture e coverage variabili Mancanza regioni di regolazione Mancanza regioni non codificanti ultra-conservate Whole genome sequencing?

10 Whole genome sequencing: sfide > varianti! Identificare nuovi geni malattia nel background di varianti non patogeniche ed errori di sequenza Dare un senso alle varianti non codificanti

11 NGS nella diagnostica clinica: l exome sequencing Ha utilità provata in pazienti con: Presentazione atipica (IBD, Worthey Genet, Med 2011) Non attribuibili a categorie distinte (ritardo mentale, Vissers, Nat Genet 2010) Lista di geni candidati troppo lunga (Charcot-Marie-Tooth, Montenegro, Ann Neurol 2011)

12 Target-enrichment strategies for NGS Mamanova, Nat Methods 2010

13 Single target for many samples

14 NGS negli screening

15 NGS nella diagnostica: sfide Metodologia error rates di sequenziamento identificare le varianti strutturali procedure standard Interpretazione database esaustivo delle mutazioni rare integrazione tra mutazioni rare, varianti comuni e ambiente per tracciare i profili di rischio approccio a team (clinico, genetista, bioinformatico, bioetico) Etica consenso informato Incidental findings e loro comunicazione

16 SINGLE PATIENTS, SINGLE DISORDERS?

17 EXOME SEQUENCING vs. TRADITIONAL APPROACHES From Gilissen 2011

18 EXOME ANALYSIS PIPELINE

19 COMBINING EXOME AND HOMOZYGOSITY MAPPING OMIM: FA2H Cytogenetic location: 16q23.1 Chr 16: 16:74,746,852-74,808,728

20 COMBINING EXOME AND HOMOZYGOSITY MAPPING EFCAB6 p.l731f FA2H c.270+3a>t KIAA1407 c.1246_1246delg

21 MATtIA SYNDROME Microcephaly, Agenesis of the corpus callosum, Tetraparesis, AND epilepsy

22 LINKAGE ANALYSIS Xq21.33q24 DXS DXS ,5 Mb (95,16-119,82 Mb) 250 genes

23 CANDIDATE VARIANTS

24 OVERLAP WITH X-L MENTAL RETARDATION Isolato Sindromico XLMR Update del Greenwood Genetic Center, > 90 geni responsabili di ritardo mentale Diverse categorie funzionali implicate (enzimi, mediatori della trasduzione del segnale, proteine di legame, trasportatori e fattori di trascrizione) Processi cellulari implicati: trasporto delle vescicole sinaptiche (proteine Rab) formazione e maturazione dei dendriti (Rho GTPasi) trascrizione genica (pathway RAS/MAPK)

25 X-linked tetra amelia Sindrome estremamente rara caratterizzata da: totale assenza di tutti e quattro gli arti ampia serie di anomalie a livello del cranio, del sistema urogenitale, dei polmoni, dello scheletro e del sistema nervoso centrale Nell'uomo, la tetra-amelia è stata associata a mutazioni in WNT3 e WNT7a Il topo KO per Fgf10 è tetramelico

26 VARIANT DISCOVERY

27 TBX22 E CPX Mutazioni in TBX22 causano cleft palate con anchiloglossia (CPX OMIM#303400). Sono state descritte mutazioni di diverso tipo che causano CPX: missense, nonsense, indel e splice-site, la stragrande maggioranza delle quali si localizzano all'interno o nelle immediate vicinanze del dominio T-box. Tutte le mutazioni determinano un meccanismo di loss of function a livello proteico aboliscono o diminuiscono sensibilmente il legame della proteina al DNA inibiscono la sumoilazione L espressione di TBX22 nel palato è ben caratterizzata, in particolare Pauws e colleghi hanno generato un topo Tbx22 null che mostra cleft palate e anchiloglossia

28 UN POSSIBILE LINK TRA TBX22 E TETRA-AMELIA Espressione di Tbx22 nell embrione di pollo: somiti archi della faringe mascella occhi abbozzi degli arti inferiori e superiori E4, HH stadio 24 Coinvolgimento di geni Tbx nello sviluppo degli arti nel pollo mutazioni in TBX4 causano la small patella syndrome mutazioni in TBX5 causano la Holt-Oram syndrome

29 Grazie dell attenzione

Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica. Corrado Romano cromano@oasi.en.it

Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica. Corrado Romano cromano@oasi.en.it Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica Corrado Romano cromano@oasi.en.it Genetica Clinica secondo Wikipedia La genetica clinica o medica si occupa dello studio e della diagnosi delle

Dettagli

Nuove prospettive nella diagnostica molecolare delle malattie rare: l'uso del Next Generation Sequencing per l'identificazione dei geni causativi

Nuove prospettive nella diagnostica molecolare delle malattie rare: l'uso del Next Generation Sequencing per l'identificazione dei geni causativi Nuove prospettive nella diagnostica molecolare delle malattie rare: l'uso del Next Generation Sequencing per l'identificazione dei geni causativi Marco Seri (sottotitolo preso in prestito dal Prof. R.

Dettagli

Aggiornamenti in ambito genetico

Aggiornamenti in ambito genetico 10 Congresso Nazionale sulla Sindrome di Cornelia de Lange 1-4 novembre 2012 - Gabicce Aggiornamenti in ambito genetico Cristina Gervasini Genetica Medica Dip. Scienze della Salute Università degli Studi

Dettagli

Quotidiano. www.ecostampa.it

Quotidiano. www.ecostampa.it Quotidiano 097156 www.ecostampa.it Quotidiano 097156 www.ecostampa.it Lettori: 2.835.000 Diffusione: 431.913 12-NOV-2013 Dir. Resp.: Ezio Mauro da pag. 1 Lettori: 2.835.000 Diffusione: 431.913 12-NOV-2013

Dettagli

A IFE F G 16 1-17 1 7 O

A IFE F G 16 1-17 1 7 O Colorectal Cancer in a young patient with Partial Androgen Insensitivity Syndrome (PAIS) Stefano Signoroni Unit of Hereditary Digestive Tract Tumours, Department of Preventive and Predictive Medicine,

Dettagli

Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING. dott.ssa Alessandra Cuccurullo

Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING. dott.ssa Alessandra Cuccurullo Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING dott.ssa Alessandra Cuccurullo EXOME SEQUENCING Anche noto come targeted exome capture. Strategia per sequenziare selettivamente

Dettagli

Sindrome di Sotos: Difetto genetico di base: gene NSD1 e analisi di mutazioni Marina Grasso Laboratorio Genetica Umana E.O.

Sindrome di Sotos: Difetto genetico di base: gene NSD1 e analisi di mutazioni Marina Grasso Laboratorio Genetica Umana E.O. Sindrome di Sotos: Difetto genetico di base: gene NSD1 e analisi di mutazioni Marina Grasso Laboratorio Genetica Umana E.O. Ospedali Galliera XVIII Congresso Nazionale Associazione Gulliver Monza 08 marzo

Dettagli

La prevenzione: un piano regionale per la Puglia. Perché?

La prevenzione: un piano regionale per la Puglia. Perché? La prevenzione: un piano regionale per la Puglia. Perché? Rita Fischetto Referente Genetica Clinica U.O.C. Malattie Metaboliche Diabetologia A.O.U. Policlinico-Giovanni XXIII Bari -CRESCITA CONOSCENZE

Dettagli

Progetto sulle esostosi multiple

Progetto sulle esostosi multiple Progetto sulle esostosi multiple PROGETTO SULLE ESOSTOSI MULTIPLE EREDITARIE Dott. Leonardo D Agruma Servizio di Genetica Medica - Dipartimento dell Età Evolutiva IRCCS Ospedale Casa Sollievo della Sofferenza

Dettagli

Genetica, malattie rare e contesto familiare

Genetica, malattie rare e contesto familiare XXV Anniversario IRCCS E. Medea La salute del bambino tra genetica e neuroscienze Bosisio Parini, 11 dicembre 2010 Genetica, malattie rare e contesto familiare La genetica negli ultimi 25 anni Sequenziamento

Dettagli

Bruno Dallapiccola. Perché parlare di malattie rare?

Bruno Dallapiccola. Perché parlare di malattie rare? Bruno Dallapiccola Perché parlare di malattie rare? Perché parlare di malattie rare? «La storia ci ha insegnato che una parte significativa delle conoscenze della medicina è stata acquisita attraverso

Dettagli

http://biocloud.unica.it biocloud@unica.it Emanuele Pascariello emanuele.pascariello@gmail.com

http://biocloud.unica.it biocloud@unica.it Emanuele Pascariello emanuele.pascariello@gmail.com Giornate sugli sbocchi professionali Del corso di Laurea in Biotecnologie Industriali (BIOTIN) Oristano 23/24 Aprile 2013 URL email http://biocloud.unica.it biocloud@unica.it Emanuele Pascariello emanuele.pascariello@gmail.com

Dettagli

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece Clinica e terapia delle malattie retiniche Direttore Scientifico Alfredo Pece Genetica LA GENETICA Cosa sta succedendo nell ambito della diagnostica e della terapia farmacologica oggi? Scoperta di geni

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING

INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING Il test OncoScreening OncoScreening è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi multipla per valutare

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN

INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN Il test ColonScreen ColonScreen è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi genetica multipla per valutare

Dettagli

Prof. Pier Paolo Piccaluga Università di Bologna

Prof. Pier Paolo Piccaluga Università di Bologna Prof. Pier Paolo Piccaluga Università di Bologna DNA: la molecola della vita L'acido desossiribonucleico (DNA) è un acido nucleico, presente nel nucleo delle cellule, che contiene le informazioni genetiche

Dettagli

La sindrome di Lynch. Cancro colonrettale ereditario non poliposico o HNPCC. G. A. Pablo Cirrone. lunedì 11 marzo 2013

La sindrome di Lynch. Cancro colonrettale ereditario non poliposico o HNPCC. G. A. Pablo Cirrone. lunedì 11 marzo 2013 La sindrome di Lynch Cancro colonrettale ereditario non poliposico o HNPCC G. A. Pablo Cirrone 1 Caratteristiche generali I HNPCC (Hereditary Non-Polyposis Colonrectal Cancer) è caratterizzato dalla comparsa,

Dettagli

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo 2 Convegno Nazionale Sindrome di Rubinstein Taybi Lodi, 17 19 maggio 2013 A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo Donatella Milani Cristina

Dettagli

SINDROMI MIELODISPLASTICHE

SINDROMI MIELODISPLASTICHE SINDROMI MIELODISPLASTICHE MECCANISMI MOLECOLARI R. Piazza MECCANISMI MOLECOLARI Bejar R et al. JCO 2011;29:504-515 NEXT GENERATION SEQUENCING Flowcell NEXT GENERATION SEQUENCING Library di DNA Genomic

Dettagli

Ruolo della biologia molecolare nel carcinoma ovarico

Ruolo della biologia molecolare nel carcinoma ovarico Carcinoma ovarico avanzato: quali novità per il 2015? Ruolo della biologia molecolare nel carcinoma ovarico Anna Pesci Ospedale SC Don Calabria, Negrar anna.pesci@sacrocuore.it TIPO I TIPO II Basso stadio

Dettagli

Dr.ssa Gabriella Silvestri Istituto di Neurologia, UCSC, Fondazione Policlinico A. Gemelli Roma Dr.ssa Marcella Masciullo IRCSS Santa Lucia, Roma

Dr.ssa Gabriella Silvestri Istituto di Neurologia, UCSC, Fondazione Policlinico A. Gemelli Roma Dr.ssa Marcella Masciullo IRCSS Santa Lucia, Roma Ereditarietà delle PSE e counselling genetico Dr.ssa Gabriella Silvestri Istituto di Neurologia, UCSC, Fondazione Policlinico A. Gemelli Roma Dr.ssa Marcella Masciullo IRCSS Santa Lucia, Roma Paraparesi

Dettagli

Bioinformatica. Marin Vargas, Sergio Paul

Bioinformatica. Marin Vargas, Sergio Paul Bioinformatica Marin Vargas, Sergio Paul 2013 Wikipedia: La bioinformatica è una disciplina scientifica dedicata alla risoluzione di problemi biologici a livello molecolare con metodi informatici. La bioinformatica

Dettagli

Profilo aziendale. Prodotti e servizi per il mercato italiano

Profilo aziendale. Prodotti e servizi per il mercato italiano Profilo aziendale La ATLAS Biolabs GmbH è fornitore leader di servizi di genomica su microarray, quali espressione genica sull intero genoma e analisi degli SNP, analisi CGH e servizi diagnostici per dottori

Dettagli

L informazione ottenuta dal test genetico può apportare notevoli benefici, quali:

L informazione ottenuta dal test genetico può apportare notevoli benefici, quali: INFORMATIVA E CONSENSO INFORMATO ALL ESAME BREASTSCREEN Il test BreastScreen BreastScreen è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi genetica multipla per valutare

Dettagli

Exome sequencing in sporadic autism spectrum disorders identifies severe de novo mutations

Exome sequencing in sporadic autism spectrum disorders identifies severe de novo mutations Exome sequencing in sporadic autism spectrum disorders identifies severe de novo mutations Brian J O Roak1, Pelagia Deriziotis2, Choli Lee1, Laura Vives1, Jerrod J Schwartz1, Santhosh Girirajan1, Emre

Dettagli

GENETICA DELLE MALATTIE COMPLESSE. Dr. Giovanni Malerba Biologia e Genetica, UniVR giovanni.malerba@univr.it

GENETICA DELLE MALATTIE COMPLESSE. Dr. Giovanni Malerba Biologia e Genetica, UniVR giovanni.malerba@univr.it GENETICA DELLE MALATTIE COMPLESSE Dr. Giovanni Malerba Biologia e Genetica, UniVR giovanni.malerba@univr.it CARATTERE COMPLESSO Predisposizione Genetica interazione Diagnosi Prevenzione Terapia efficiente

Dettagli

Analisi del genoma umano: possibilità e limiti. Francesca Lugani, MD, PhD U.O.C. Nefrologia, dialisi e trapianto IRCCS G. Gaslini

Analisi del genoma umano: possibilità e limiti. Francesca Lugani, MD, PhD U.O.C. Nefrologia, dialisi e trapianto IRCCS G. Gaslini Analisi del genoma umano: possibilità e limiti Francesca Lugani, MD, PhD U.O.C. Nefrologia, dialisi e trapianto IRCCS G. Gaslini What is DNA? It's a history book - a narrative of the journey of our species

Dettagli

Conoscenze, capacità, e comportamenti che ci si ripromette di trasmettere o sviluppare, con riferimento agli obiettivi di apprendimento

Conoscenze, capacità, e comportamenti che ci si ripromette di trasmettere o sviluppare, con riferimento agli obiettivi di apprendimento Docente: HAYEK JOUSSEF Qualifica: DIRIGENTE MEDICO AOUS Insegnamento: NEUROPSICHIATRIA INFANTILE SSD: MED/39 Anno III o Descrivere l approccio clinico-strumentale al bambino con deficit intellettivo isolato

Dettagli

Oggetto: presentazione progetto di ricerca anno 2010

Oggetto: presentazione progetto di ricerca anno 2010 Associazione Un Vero Sorriso Onlus via Morghen, 5 10143 Torino Torino, 01/10/2010 Oggetto: presentazione progetto di ricerca anno 2010 Titolo: Nuovi approcci per l identificazione di mutazioni rare in

Dettagli

DATABASE DI GENETICA E BIOLOGIA MOLECOLARE

DATABASE DI GENETICA E BIOLOGIA MOLECOLARE DATABASE DI GENETICA E BIOLOGIA MOLECOLARE OMIM Online Mendelian Inheritance in Man EntrezGene curated sequence and descriptive information about genetic loci GenCards HGMD dbsnp database of human genes,

Dettagli

UNIVERSITÀ DEGLI STUDI DI PAVIA Servizio Qualità della Didattica e Servizi agli Studenti

UNIVERSITÀ DEGLI STUDI DI PAVIA Servizio Qualità della Didattica e Servizi agli Studenti All. J al bando di ammissione pubblicato in data 30/10/2015 ART. 1 - TIPOLOGIA L Università degli studi di Pavia attiva, per l a.a. 2015/2016, presso il Dipartimento di Scienze del Sistema Nervoso e del

Dettagli

GENETICA DEL TUMORE DEL COLON-RETTO

GENETICA DEL TUMORE DEL COLON-RETTO GENETICA DEL TUMORE DEL COLON-RETTO EPIDEMIOLOGIA In tutto l'occidente, il cancro del colon-retto occupa, per incidenza, il secondo posto tra i tumori maligni, preceduto dal tumore al polmone nell'uomo

Dettagli

La rete dei centri di genetica e il futuro della medicina

La rete dei centri di genetica e il futuro della medicina La rete dei centri di genetica e il futuro della medicina Rosario Casalone,, MD, PhD SSD Genetica Dipartimento Materno Infantile Azienda Ospedaliera-Polo Universitario Ospedale di Circolo e Fondazione

Dettagli

Varianti del genoma umano

Varianti del genoma umano 1000 genomes Varianti del genoma umano dbsnp 132 30,442,771 SNP (1% del genoma) Varianti strutturali (DGV) CNVs: 66741 Inversioni: 953 InDels (100bp-1Kb): 34229 Total CNV loci: 15963 35% del genoma Obiettivi

Dettagli

Dal paziente al gene malattia : il clonaggio posizionale del gene Met

Dal paziente al gene malattia : il clonaggio posizionale del gene Met Dal paziente al gene malattia : il clonaggio posizionale del gene Met Una storia di interazione fra Medicina e Ricerca a cura di Debora Angeloni, Ph.D., Settore di Medicina Scuola Estiva di Orientamento

Dettagli

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136)

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) Il gene implicato nella SCA17 è il gene TATA box-binding protein (TBP) che fa parte del complesso della RNA polimerasi II ed è essenziale per dare inizio

Dettagli

Biobanca Genetica per Malattie Rare Scheletriche

Biobanca Genetica per Malattie Rare Scheletriche Biobanca Genetica per Malattie Rare Scheletriche Luca Sangiorgi S.S.D. di Genetica Medica e Malattie Rare Ortopediche, Istituto Ortopedico Rizzoli Bologna SSD di Genetica Medica IOR Roma, 25 settembre

Dettagli

II LEZIONE. Database di interesse per la genetica e la biologia molecolare. Portali per l'accesso a database e servizi bioinformatici

II LEZIONE. Database di interesse per la genetica e la biologia molecolare. Portali per l'accesso a database e servizi bioinformatici II LEZIONE Database di interesse per la genetica e la biologia molecolare Portali per l'accesso a database e servizi bioinformatici DATABASE DI GENETICA E BIOLOGIA MOLECOLARE OMIM Online Mendelian Inheritance

Dettagli

Gene Mutations and Disease

Gene Mutations and Disease Gene Mutations and Disease Mutazioni somatiche: Nuove mutazioni che insorgono casualmente nelle cellule somatiche o nella linea germinale di singoli individui. Le mutazioni germinali possono essere trasmesse

Dettagli

UNIVERSITÀ DEGLI STUDI DI PAVIA

UNIVERSITÀ DEGLI STUDI DI PAVIA All. F al bando di ammissione pubblicato in data 05/11/201 Art. 1 - Tipologia L Università degli studi di Pavia attiva, per il biennio accademico 201/2015, presso il Dipartimento di Scienze del Sistema

Dettagli

MUTATION DETECTION DIRECT SEQUENCING OF DNA FRAGMENTS

MUTATION DETECTION DIRECT SEQUENCING OF DNA FRAGMENTS MUTATION DETECTION DIRECT SEQUENCING OF DNA FRAGMENTS DIRECT SEQUENCING TTCACTGAGAGTCGC TCCCAATAAAAGTGACTCTCAGCGAGC TTCACTGAGAGTCGG TCCCAATAAAAGTGACTCTCAGCCAGC wt mut wt wt/mut mut The Sanger method 07_01.jpg

Dettagli

TEST DEL DNA FETALE PRIVO DI RISCHI PER RILEVARE LA SINDROME DI DOWN E LE ANOMALIE CROMOSOMICHE PIÙ COMUNI

TEST DEL DNA FETALE PRIVO DI RISCHI PER RILEVARE LA SINDROME DI DOWN E LE ANOMALIE CROMOSOMICHE PIÙ COMUNI TEST DEL DNA FETALE PRIVO DI RISCHI PER RILEVARE LA SINDROME DI DOWN E LE ANOMALIE CROMOSOMICHE PIÙ COMUNI SICURO: Eseguito su un semplice prelievo di sangue materno COMPLETO: Trisomia 21 (Sindrome di

Dettagli

UNIVERSITÀ DEGLI STUDI DI PAVIA Servizio Qualità della Didattica e Servizi agli Studenti

UNIVERSITÀ DEGLI STUDI DI PAVIA Servizio Qualità della Didattica e Servizi agli Studenti All. C al bando di ammissione pubblicato in data 0/11/201 Art. 1 - Tipologia L Università degli studi di Pavia attiva per il biennio accademico 201/2016, il Master Universitario biennale di II livello

Dettagli

Paraplegie Spastiche Ereditarie - PSE

Paraplegie Spastiche Ereditarie - PSE LE PARAPLEGIE SPASTICHE EREDITARIE: Una malattia, molti geni e molti ancora da scoprire E. Storti A. Tessa F. M. Santorelli Paraplegie Spastiche Ereditarie - PSE Cos è una paraparesi spastica ereditaria

Dettagli

La Biopsia Prostatica: where are we going?

La Biopsia Prostatica: where are we going? La Biopsia Prostatica: where are we going? Sabato 28 Novembre 2015, Catania Dott. Michele Salemi Screening genetico correlato a rischio di carcinoma prostatico. BRCA1, BRCA2, TP53, CHEK2, HOXB13 e NBN:

Dettagli

L adattamento dei batteri. Strategie di adattamento

L adattamento dei batteri. Strategie di adattamento L adattamento dei batteri Strategie di adattamento mutazione trasferimento genico orizzontale regolazione dell espressione genica regolazione della trascrizione regolazione della traduzione regolazione

Dettagli

NOVITA NELL INQUADRAMENTO GENETICO

NOVITA NELL INQUADRAMENTO GENETICO NOVITA NELL INQUADRAMENTO GENETICO Dott.ssa Angela Michelucci U.O. Laboratorio di Genetica Medica AOUP Definizione della Discinesia Ciliare Primaria (DCP) Gruppo di condizioni patologiche congenite, eterogenee

Dettagli

via Santena, 19-10126 Torino - Italy UNIVERSITÀ DEGLI STUDI Tel: +39 011 6334480 Fax: +39 011 6706582 DI TORINO

via Santena, 19-10126 Torino - Italy UNIVERSITÀ DEGLI STUDI Tel: +39 011 6334480 Fax: +39 011 6706582 DI TORINO Associazione Un Vero Sorriso Onlus via Morghen, 5 10143 Torino Torino, 21/02/2011 Progetto di ricerca: Utilizzo di oligonucleotidi antisenso per correggere l effetto di mutazioni di splicing in pazienti

Dettagli

PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica PRODA Istituto di Diagnostica Clinica Sezione di Citogenetica e Genetica molecolare Responsabile: Dott. Guglielmo Sabbadini Specialista in Genetica Medica Informazioni per la diagnosi molecolare di sordita

Dettagli

FIRST INTERNATIONAL MEETING ON CDKL5 RARE DISEASE

FIRST INTERNATIONAL MEETING ON CDKL5 RARE DISEASE FIRST INTERNATIONAL MEETING ON CDKL5 RARE DISEASE Bologna, Italy April 27-29, 2012 Department of Human and General Physiology, University of Bologna, Piazza di Porta San Donato 2, Bologna Sede del convegno

Dettagli

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la

Dettagli

Dissezione del fenotipo

Dissezione del fenotipo Clinica molecolare (molecular medicine):come utilizzare le informazioni del genoma per studiare le patologie genetiche Clinica molecolare Nuova branca della medicina che nasce 2.400 anni fa con Democrito

Dettagli

Genetica dell autismo: il percorso diagnostico e le nuove tecnologie di indagine molecolare

Genetica dell autismo: il percorso diagnostico e le nuove tecnologie di indagine molecolare Genetica dell autismo: il percorso diagnostico e le nuove tecnologie di indagine molecolare Dr.Rosario Casalone SSD Genetica Azienda Ospedaliera Universitaria Ospedale di Circolo e Fondazione Macchi Varese

Dettagli

INFORMATIVA ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI

INFORMATIVA ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI INFORMATIVA ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI A. Finalità L indagine citogenetica fetale (o cariotipo) viene eseguita su cellule

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015 Docente: Silvia Fuselli fss@unife.it Fonti e testi di riferimento Dan Graur: http://nsmn1.uh.edu/dgraur/ >courses > bioinformatics

Dettagli

Sequenziamento ed analisi dell esoma intero (All Exon)

Sequenziamento ed analisi dell esoma intero (All Exon) Sequenziamento ed analisi dell esoma intero (All Exon) Obiettivi La procedura ha l obiettivo di sequenziare solo le regioni trascritte e codificanti del genoma che rappresentano, almeno nell uomo, circa

Dettagli

Elementi di Patologia Generale Dott.ssa Samantha Messina Lezione: Patologia Genetica

Elementi di Patologia Generale Dott.ssa Samantha Messina Lezione: Patologia Genetica Elementi di Patologia Generale Dott.ssa Samantha Messina Lezione: Patologia Genetica Anno accademico 2009/2010 I anno, II semestre CdL Infermieristica e Fisioterapia PATOLOGIA GENETICA Oggetto di studio

Dettagli

Il test genetico BRCA1/BRCA2

Il test genetico BRCA1/BRCA2 L identificazione Il test genetico BRCA1/BRCA2 M.G.Tibiletti UO Anatomia Patologica Ospedale di Circolo-Università dell Insubria Varese IL CARCINOMA MAMMARIO FORME SPORADICHE FORME EREDITARIE FORME FAMIGLIARI

Dettagli

Array-CGH(Comparative Genomic Hybridisation) e diagnosi prenatale. Dalla citogenetica convenzionale alla citogenetica molecolare!

Array-CGH(Comparative Genomic Hybridisation) e diagnosi prenatale. Dalla citogenetica convenzionale alla citogenetica molecolare! Array-CGH(Comparative Genomic Hybridisation) e diagnosi prenatale Dalla citogenetica convenzionale alla citogenetica molecolare! CARIOTIPO STANDARD Identifica anomalie strutturali bilanciate e sbilanciate

Dettagli

6. Capacity Building, programma pubblico di interventi

6. Capacity Building, programma pubblico di interventi 6. Capacity Building, programma pubblico di interventi 6.1. Premessa Al fine di rendere più efficaci, efficienti e condivisi gli interventi e le azioni nel settore della Genomica in Sanità Pubblica, è

Dettagli

Il tra'amento chirurgico e il follow up postchirurgico nello screening

Il tra'amento chirurgico e il follow up postchirurgico nello screening Il tra'amento chirurgico e il follow up postchirurgico nello screening Bruno Andreoni Divisione Chirurgia Generale IEO Facoltà Medicina - Milano Tra'amento chirurgico tumori colon re'o screen detected

Dettagli

Progetto CIMDL. Analisi genetica di pazienti affetti da lesioni distruttive della linea mediana indotte da Cocaina (CIMDL) tramite exome sequencing

Progetto CIMDL. Analisi genetica di pazienti affetti da lesioni distruttive della linea mediana indotte da Cocaina (CIMDL) tramite exome sequencing Progetto CIMDL Analisi genetica di pazienti affetti da lesioni distruttive della linea mediana indotte da Cocaina (CIMDL) tramite exome sequencing Centro Collaborativo DPA IRCCS Ospedale San Raffaele -

Dettagli

AGGIORNAMENTI IN TEMA DI PREVENZIONE. Sindrome di Crisponi: approccio diagnostico, correlazione genotipo/fenotipo e strategie terapeutiche

AGGIORNAMENTI IN TEMA DI PREVENZIONE. Sindrome di Crisponi: approccio diagnostico, correlazione genotipo/fenotipo e strategie terapeutiche AGGIORNAMENTI IN TEMA DI PREVENZIONE Sindrome di Crisponi: approccio diagnostico, correlazione genotipo/fenotipo e strategie terapeutiche LA PREVENZIONE DELLE MALATTIE RARE Cagliari, 16 Ottobre 2015 Laura

Dettagli

La Genomica in Sanità Pubblica I Convegno Siciliano

La Genomica in Sanità Pubblica I Convegno Siciliano La Genomica in Sanità Pubblica I Convegno Siciliano Catania, 18 Dicembre 2014 Nuove tecnologiche nella genomica in sanità pubblica Marco Fichera Università di Catania A.O.U. Policlinico V.E. Catania 1

Dettagli

SCREENING NEONATALE RISPARMIO PER IL SERVIZIO SANITARIO NAZIONALE?

SCREENING NEONATALE RISPARMIO PER IL SERVIZIO SANITARIO NAZIONALE? SCREENING NEONATALE GENETICO RISPARMIO PER IL SERVIZIO SANITARIO NAZIONALE? Pietro Chiurazzi Istituto di Genetica Medica Facoltà di Medicina e Chirurgia Università Cattolica Associazione Culturale Giuseppe

Dettagli

"Sotto l'azzurro fitto del cielo qualche uccello di mare se ne va, nè sosta mai perchè tutte le immagini portano scritto più in là".

Sotto l'azzurro fitto del cielo qualche uccello di mare se ne va, nè sosta mai perchè tutte le immagini portano scritto più in là. Lentamente muore chi diventa schiavo dell'abitudine, ripetendo ogni giorno gli stessi percorsi, chi non cambia la marca, chi non rischia e cambia colore dei vestiti, chi non parla a chi non conosce. Muore

Dettagli

HI-TECH IN SANITA'. MINI-INVASIVITA' 2.0: nuove tecnologie al servizio dell'appropriatezza e della bioetica professionale

HI-TECH IN SANITA'. MINI-INVASIVITA' 2.0: nuove tecnologie al servizio dell'appropriatezza e della bioetica professionale HI-TECH IN SANITA'. MINI-INVASIVITA' 2.0: nuove tecnologie al servizio dell'appropriatezza e della bioetica professionale L evoluzione della professione tecnica tra robotica, automazione e nuove tecnologie

Dettagli

Stato mutazionale del gene K-RAS: K comparazione di metodi di analisi

Stato mutazionale del gene K-RAS: K comparazione di metodi di analisi IV Congresso Regionale I Congresso del Middle Management di Area Tecnica Federazione Italiana Tecnici di Laboratorio Biomedico Stato mutazionale del gene K-RAS: K comparazione di metodi di analisi Dott.ssa

Dettagli

PROGRESS IN STEM CELL BIOLOGY AND MEDICAL APPLICATIONS 12/01/13

PROGRESS IN STEM CELL BIOLOGY AND MEDICAL APPLICATIONS 12/01/13 PROGRESS IN STEM CELL BIOLOGY AND MEDICAL APPLICATIONS Fare clic Stresa 14-16 per modificare maggio 2009 lo stile del sottotitolo dello schema Self-renewal vs differentiation Controllo del self renewal

Dettagli

Esercitazioni di Genomica

Esercitazioni di Genomica Bioinformatica ai tempi del NGS, PhD CRIBI Biotechnology Center, University of Padua BMR Genomics srl, Spin-Off Giovanni Birolo, PhD CRIBI Biotechnology Center, University of Padua Perché bioinformatica?

Dettagli

Portatore Malattia genetica.mutazione. La sottoscritta...nata a.il. Portatrice Malattia genetica Mutazione. PREMESSO. con il/la Dott.

Portatore Malattia genetica.mutazione. La sottoscritta...nata a.il. Portatrice Malattia genetica Mutazione. PREMESSO. con il/la Dott. CONSENSO INFORMATO PER DIAGNOSI GENETICA PRE-IMPIANTO (PGD)* PER MALATTIE GENETICHE EREDITARIE O ALTERAZIONI CROMOSOMICHE NUMERICHE E/O STRUTTURALI SBILANCIATE. *(Preimplantation Genetic Diagnosis) Ai

Dettagli

Corso Integrato di Genetica e Biologia Molecolare GENETICA

Corso Integrato di Genetica e Biologia Molecolare GENETICA Corso Integrato di Genetica e Biologia Molecolare GENETICA a.a.2015-2016 Pier Franco Pignatti 7.10.2015 Lezioni N. 3 e 4 Ereditarietà mendeliana, malattie autosomiche dominanti (Neri-Genuardi cap.6) Segregazione

Dettagli

Lo stato dell'arte in Farmacogenetica e Farmacogenomica

Lo stato dell'arte in Farmacogenetica e Farmacogenomica Lo stato dell'arte in Farmacogenetica e Farmacogenomica Maria Cristina Rosatelli Dipartimento di Scienze Biomediche e Biotecnologie Università degli Studi di Cagliari XXXI Congresso nazionale Variabilità

Dettagli

GENI E TEST GENETICI: DAL LABORATORIO ALLA PRATICA CLINICA

GENI E TEST GENETICI: DAL LABORATORIO ALLA PRATICA CLINICA PROGRAMMA CORSO ECM 2015 SCUOLA MEDICA OSPEDALIERA OSPEDALE S.SPIRITO IN SAXIA IN ROMA (richiesto il PATROCINIO SIGU) Responsabili scientifici: Guglielmo Sabbadini, Mariano S. Pergola Comitato Scientifico:

Dettagli

DOTTORATO DI RICERCA TITOLO TESI

DOTTORATO DI RICERCA TITOLO TESI Università degli Studi di Cagliari DOTTORATO DI RICERCA Terapia Pediatrica e Farmacologia dello Sviluppo Ciclo XXIII TITOLO TESI STUDIO DEL RITARDO MENTALE ASPECIFICO LEGATO AL CROMOSOMA X Settore/i scientifico

Dettagli

DMM SCIENTIFIC MEETING PADOVA, 29-30 MAGGIO 2014

DMM SCIENTIFIC MEETING PADOVA, 29-30 MAGGIO 2014 DMM SCIENTIFIC MEETING PADOVA, 29-30 MAGGIO 2014 DMM SCIENTIFIC MEETING - PADOVA, 29-30 MAGGIO 2014 QUESTIONARIO RISPOSTE CORRETTE 1. I vaccini a DNA sono potenziati dall uso della elettroporazione in

Dettagli

MANIPOLAZIONE GENETICA DEGLI ANIMALI

MANIPOLAZIONE GENETICA DEGLI ANIMALI MANIPOLAZIONE GENETICA DEGLI ANIMALI Perché creare animali transgenici Per studiare la funzione e la regolazione di geni coinvolti in processi biologici complessi come lo sviluppo di un organismo e l insorgenza

Dettagli

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016 Docente: Silvia Fuselli fss@unife.it Possibili testi di riferimento Introduction to Genomics, A.M. Lesk, Oxford Capitoli 1, 3,

Dettagli

Conoscenze, capacità, e comportamenti che ci si ripromette di trasmettere o sviluppare, con riferimento agli obiettivi di apprendimento

Conoscenze, capacità, e comportamenti che ci si ripromette di trasmettere o sviluppare, con riferimento agli obiettivi di apprendimento Docente: ROSSI STEFANIA Qualifica: RICERCATORE Insegnamento: STATISTICA SSD: MED/42 o Definire gli aspetti fondamentali per la stesura di progetto/protocollo di ricerca: razionale; plausibilità biologica

Dettagli

Si tratta di una eredità non mendeliana con una trasmisione matrilineare I caratteri si trasmettono principalmente per via materna

Si tratta di una eredità non mendeliana con una trasmisione matrilineare I caratteri si trasmettono principalmente per via materna Eredità mitocondriale Si tratta di una eredità non mendeliana con una trasmisione matrilineare I caratteri si trasmettono principalmente per via materna I mitocondri dello spermatozoo non entrano a far

Dettagli

Che significa animale transgenico o animale Knockout???

Che significa animale transgenico o animale Knockout??? Che significa animale transgenico o animale Knockout??? ORGANISMI TRANSGENICI Gli animali che sono stati ingegnerizzati per inserzione di un gene, delezione di un gene o sostituzione di un gene si chiamano

Dettagli

Tappe della GENETICA UMANA. G. Mendel leggi dell ereditarietà 1865

Tappe della GENETICA UMANA. G. Mendel leggi dell ereditarietà 1865 Tappe della GENETICA UMANA G. Mendel leggi dell ereditarietà 1865 Tappe della GENETICA UMANA G. Mendel leggi dell ereditarietà 1865 Watson & Crick DNA 1953 Tappe della GENETICA UMANA G. Mendel leggi dell

Dettagli

MECCANISMI MOLECOLARI MEMORIA PROCEDURALE/IMPLICITA

MECCANISMI MOLECOLARI MEMORIA PROCEDURALE/IMPLICITA MECCANISMI MOLECOLARI MEMORIA PROCEDURALE/IMPLICITA APLYSIA: VANTAGGI: Sistema nervoso semplice Poche e grosse (1 mm) cellule riconoscibili (20.000) MEMORIA PROCEDURALE Priming Motorie Apprendimento (abilità,abitudini)

Dettagli

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi

Dettagli

Elementi di Bioinformatica per lʼanalisi di dati NGS

Elementi di Bioinformatica per lʼanalisi di dati NGS Corso di Alta formazione in Elementi di Bioinformatica per lʼanalisi di dati NGS 21-23 Settembre 2011 Centro Didattico Morgagni Viale Morgagni 40, Firenze Presentazione del corso Il corso di alta formazione

Dettagli

Lezioni di genetica medica. Specializzazioni 2014

Lezioni di genetica medica. Specializzazioni 2014 Lezioni di genetica medica Specializzazioni 2014 Programma, parte 1 genetica umana generale Il genoma umano: geni ed organizzazione Next generation sequencing (NGS), l'exoma Eterogeneità clinica ed eterogeneità

Dettagli

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione

Dettagli

Unità Operativa di GENETICA MEDICA. Azienda Ospedaliera Universitaria S.Anna AOSPFE, Ferrara. Prestazioni richieste

Unità Operativa di GENETICA MEDICA. Azienda Ospedaliera Universitaria S.Anna AOSPFE, Ferrara. Prestazioni richieste Unità Operativa di GENETICA MEDICA Azienda Ospedaliera Universitaria S.Anna AOSPFE, Ferrara Direttore: Prof.ssa Alessandra Ferlini www.ospfe.it/geneticamedica LABORATORIO DI GENETICA MOLECOLARE Responsabile:

Dettagli

Esercitazioni di Genomica

Esercitazioni di Genomica Esercitazioni di Genomica Bioinformatica ai tempi del NGS, PhD CRIBI Biotechnology Center, University of Padua BMR Genomics srl, Spin-Off Giovanni Birolo, PhD CRIBI Biotechnology Center, University of

Dettagli

FINALITA : evidenziare la. cromosomiche fetali.

FINALITA : evidenziare la. cromosomiche fetali. Il Cariotipo Fetale Molecolare l (array-cgh) Il Cariotipo Fetale e TRADIZIONALE FINALITA : evidenziare la presenza di eventuali anomalie cromosomiche fetali. TECNICA: comporta la coltura delle cellule

Dettagli

Screening dei soggetti a rischio e diagnostica molecolare

Screening dei soggetti a rischio e diagnostica molecolare Screening dei soggetti a rischio e diagnostica molecolare Daniela Furlan U.O. Anatomia Patologica Varese, 3 luglio 2012 Il carcinoma pancreatico Patogenesi Suscettibilità genetica Implicazioni diagnostiche

Dettagli

Contributo. Tavoli tematici. 1. Dati proponente contributo VERSO LA STRATEGIA REGIONALE DELL INNOVAZIONE 2014-2020

Contributo. Tavoli tematici. 1. Dati proponente contributo VERSO LA STRATEGIA REGIONALE DELL INNOVAZIONE 2014-2020 VERSO LA STRATEGIA REGIONALE DELL INNOVAZIONE 2014-2020 Tavoli tematici Contributo 1 1. Dati proponente contributo Alfredo Ferro Ente/organizzazione di appartenenza Università di Catania Telefono 3666627657

Dettagli

MICRODELEZIONI DEL BRACCIO LUNGO DEL CROMOSOMA Y

MICRODELEZIONI DEL BRACCIO LUNGO DEL CROMOSOMA Y L infertilità è considerata dall Organizzazione Mondiale della Sanità una patologia. Per infertilità si intende l assenza di concepimento dopo 12/24 mesi di rapporti mirati non protetti. Il fenomeno dell

Dettagli

La genetica della Sindrome di Prader-Willi

La genetica della Sindrome di Prader-Willi La genetica della Sindrome di Prader-Willi Dott.ssa Milan Gabriella Laboratorio Endocrino Metabolico DIPARTIMENTO DI SCIENZE MEDICHE E CHIRURGICHE Università degli Studi di Padova Clinica Medica 3 Prader,

Dettagli

REGIONE DEL VENETO AZIENDA OSPEDALIERA DI PADOVA AVVISO DI PROCEDURA COMPARATIVA

REGIONE DEL VENETO AZIENDA OSPEDALIERA DI PADOVA AVVISO DI PROCEDURA COMPARATIVA REGIONE DEL VENETO AZIENDA OSPEDALIERA DI PADOVA AVVISO DI PROCEDURA COMPARATIVA per l assegnazione di una borsa di studio a favore di candidati in possesso del Diploma di laurea specialistica o magistrale

Dettagli

Metodi in vivo e in vitro per : il riconoscimento dei farmaci lo studio delle loro proprietà farmacologiche lo studio del loro meccanismo d azione

Metodi in vivo e in vitro per : il riconoscimento dei farmaci lo studio delle loro proprietà farmacologiche lo studio del loro meccanismo d azione Metodi in vivo e in vitro per : il riconoscimento dei farmaci lo studio delle loro proprietà farmacologiche lo studio del loro meccanismo d azione Metodi generali Metodi mirati Scoperta e sviluppo di nuovi

Dettagli

CORSO INTEGRATO DI GENETICA a.a. 2012-2013. Genetica molecolare in medicina: Analisi di Mutazioni. Cristina Bombieri 6 novembre 2012

CORSO INTEGRATO DI GENETICA a.a. 2012-2013. Genetica molecolare in medicina: Analisi di Mutazioni. Cristina Bombieri 6 novembre 2012 CORSO INTEGRATO DI GENETICA a.a. 2012-2013 Genetica molecolare in medicina: Analisi di Mutazioni Cristina Bombieri 6 novembre 2012 APPLICAZIONI DEI POLIMORFISMI DEL DNA IDENTIFICATORI INDIVIDUALITA Controllo

Dettagli

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà Bioinformatica (1) Introduzione Dott. Alessandro Laganà Dott. Alessandro Laganà Martedi 15.30 16.30 Studio Assegnisti - 1 Piano (Davanti biblioteca) Dipartimento di Matematica e Informatica (Città Universitaria)

Dettagli

La next generation sequencing è entrata nella pratica pediatrica?

La next generation sequencing è entrata nella pratica pediatrica? Aprile-Giugno 2015 Vol. 45 N. 178 Pp. 137-142 Prospettive in Pediatria Frontiere La next generation sequencing è entrata nella pratica pediatrica? Vincenzo Nigro Dipartimento di Biochimica, Biofisica e

Dettagli